Pet vector novagen. For other reading frames, use pET-28a(+) or pET-28c(+).

Pet vector novagen. For other reading frames, use pET-28a(+) or pET-28c(+). pETDuet-1 DNA - Novagen, a vector designed for the co-expression of two target genes. pET-23 (+) is a transcription vector designed for expression from bacterial translation signals carried within a cloned insert. For other reading frames, use pET-42b (+) or pET-42c (+). Provide pET-24 (+) vector/plasmid map, full length sequence, antibiotic resistance, size and other information Novagen pET-22b (+) vector carries an N-terminal pelB signal sequence for potential periplasmic localization Over the past few years, Novagen’s pET System has become recog-nized as one of the most power-ful approaches available for producing recombinant proteins. pET-41a (+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the vector map (TB046). pETDuet™-1 DNA - Novagen pETDuet-1 is designed for the coexpression of two target genes. For complete product descriptions and ordering information, refer to the Protein Purification and Antibodies, Conjugates & Detection Tools chapters. pET-23(+). 7k Plasmids: pET & Duet Vectors (Novagen) | More Plasmid Sets pET Expression System 28 from Novagen—pET vectors plus host strains with induction control. Sequence Author: MilliporeSigma (Novagen) Novagen′s pET-26b(+) vector, purified plasmid DNA. pET-23 (+) is a transcription vector designed for expression from Provide pET-22b (+) vector/plasmid map, full length sequence, antibiotic resistance, size and other information Information Source/Vendor Novagen (EMD Millipore) Alt Name pET22b Plasmid Type Bacterial Expression Promoter AmpR, lac1 Expression Level High Cloning Method Unknown Size 5493 5' Sequencing 1 Primer T7 Fwd 5' Sequencing 1 Primer Sequence 5'd [TAATACGACTCACTATAGGG]3' Tag 1 His (Cterm) Bacterial Resistance Ampicillin Notes PelB sequence for periplasmic localization Bacterial vector for expressing Bacterial vector for expressing proteins with a cleavable N-terminal NusA tag and a cleavable C-terminal S-tag. For other reading frames, use pET-21a(+) or pET-21c(+). Bacterial vector for expression of N-terminally S-tagged proteins with an enterokinase site. Sequence Author: MilliporeSigma (Novagen) Bacterial vector with a signal sequence and a kanamycin resistance marker for expression of proteins in the periplasm. Order today! Bacterial vector for expression of N-terminally S-tagged proteins with a thrombin site. The pET-28a-c (+) vectors carry an N-terminal His-Tag/thrombin/T7-Tag configuration plus an optional C-terminal His-Tag sequence. pET-23 (+) Bacterial vector for expression of genes with bacterial translation signals. Separate components and related products: see the Novagen® catalog or Novagen web-site (www. Provide pET-28b (+) vector/plasmid map, full length sequence, antibiotic resistance, size and other information Novagen's® pET Systems Efficiently clone and express your target protein by cloning your gene into one of our industry leading bacterial, mammalian or insect cell systems. 7k Plasmids: pET & Duet Vectors (Novagen) | More Plasmid Sets pET-24d (+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. novagen. Together, we impact life and health with science. Based on the T7 promoter-driven system originally developed by Studier and colleagues (1–3), the pET System has been greatly expanded and now includes over 23 vector types, 11 different E. pET-14b Bacterial vector for expression of N-terminally 6xHis-tagged proteins. All of the pET vectors and companion products are available as kits designed for convenient cloning, expression, detection, and purification of target proteins. com) for a complete listing of pET vector DNA, systems and competent cells. Aug 30, 2025 · pET-46 Ek/LIC Vector Kit - Novagen - a LIC-compatible vector enabling expression of proteins with an N-terminal His•Tag and minimal vector-encoded sequence. Bacterial vector for inducible expression of N-terminally T7-tagged proteins. pET Expression System 23 The pET Expression System 23 contains 10 µg each of the four versions of pET-23 (pET-23a–d (+)). 7k Plasmids: pET & Duet Vectors (Novagen) | More Plasmid Sets No matches Home Plasmids pET & Duet Vectors (Novagen)pET-42a (+) Show Static Map Bacterial vector with a signal sequence for expression of C-terminally HSV-tagged proteins in the periplasm. pET-28c(+) is a 5367bp plasmid; subtract 2bp from each site beyond BamH I at 198. pET-17b Bacterial vector for expression of N-terminally T7-tagged proteins. Bacterial expression vector with a BamHI cloning site. 70072-M Novagen′s pET-32 Xa/LIC vector is designed for cloning and high-level expression of target proteins fused with the 109aa Trx-Tag thioredoxin protein, His-Tag and S-Tag coding sequences. Provide pET-21 (+) vector/plasmid map, full length sequence, antibiotic resistance, size and other information Novagen's pET-21 (+) is a transcription vector that lacks the ribosome binding site and ATG start codon present on the pET translation vectors. Expression systems have two components – the DNA vector and the host cells. Novagen′s pET-29b(+) vector, purified plasmid DNA with N-terminal S•Tag/thrombin configuration plus optional C-terminal His•Tag® sequence. Bacterial vector for expressing proteins with a cleavable N-terminal Strep-Tag II tag and a cleavable C-terminal 10xHis tag. Same reading frame as pET-21c(+) but with an NcoI site at the start codon. pETDuet-1 Bacterial vector for the co-expression of two genes. For other reading frames, use pET-28b(+) or pET-28c(+). For other reading frames, use pET-32b(+) or pET-32c(+). pET vector DNA, 10 μg each of the indicated plasmids 2 Host bacterial strains BL21, BL21(DE3) and BL21(DE3)pLysS, glycerol stocks1, Induction control clone, glycerol stock Novagen Vector Diskette containing all vector sequences (compatible with Macintosh and DOS/Windows) Bacterial vector for inducible expression of N-terminally T7-tagged proteins. Novagen′s pET-15b DNA vector, features an N-terminal His•Tag sequence followed by a thrombin site and three cloning sites. pET vector DNA, 10 g each of the indicated plasmids Host bacterial strains BL21, BL21(DE3), and BL21(DE3)pLysS, glycerol stocks1, 2 Induction control clone, glycerol stock. We offer one of the broadest portfolios in the industry for scientists, best-in-class products for pharmaceutical development and manufacturing, and a fully integrated service organization to support CDMO and contract testing across traditional and novel modalities. Buy now from Sigma-Aldrich. For other reading frames, use pET-41a(+) or pET-41c(+). coli host strains and many other companion Jan 18, 2010 · Here, the Duet™ Expression System from Novagen (part of Merck4Bioscoences) satisfies all the requirements for multiple target gene expression. The maps for pET-28b(+) and pET-28c(+) are the same as pET-28a(+) (shown) with the following exceptions: pET-28b(+) is a 5368bp plasmid; subtract 1bp from each site beyond BamH I at 198. Buy now! The pET-14b DNA vector from Novagen, carries an N-terminal His•Tag sequence followed by a thrombin cleavage site. Novagen's pET-32a (+) vector is designed for cloning and high-level expression of peptide sequences fused with the 109aa Trx•Tag™ thioredoxin protein. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the vector map (TB074). Novagen′s pET-28a-c (+) vectors carry an N-terminal His•Tag/thrombin/T7•Tag configuration plus an optional C-terminal His•Tag sequence. Order today! Pet Vector Manual Novagen's pET-32a(+) vector is designed for cloning and high-level expression of peptide sequences fused with the 109aa Trx•TagTM thioredoxin protein. Novagen′s pET-21 (+) DNA, a transcription vector lacking RBS & start codon, enables expression from cloned inserts. pET-28b (+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. For other reading frames, use pET-29a(+) or pET-29c(+). Basic Vector Information pET-28a (+) is a bacterial expression vector designed for the production of N-terminally 6xHis-tagged proteins with a thrombin cleavage site. Elevate your research potential today! The pET System is the most powerful system yet developed for the cloning and expression of recombinant proteins in Escherichia coli Target genes are cloned in pET plasmids under control of strong bacteriophage T7 transcription and (optionally) translation signals, expression is induced by providing a source of T7 RNA polymerase in the host cell Separate components and related products: see the Novagen Catalog or Novagen website (www. Bacterial vector with a kanamycin resistance marker for inducible expression of genes with bacterial translation signals. pET-21 (+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. Order now! Novagen's pET-32a (+) vector is designed for cloning and high-level expression of peptide sequences fused with the 109aa Trx•Tag™ thioredoxin protein. Sequence Author: MilliporeSigma (Novagen) Bacterial expression vector with a BamHI cloning site. Bacterial vector with a kanamycin resistance marker for inducible expression of T7-tagged proteins. Novagen′s pET-24 (+) is a transcription vector that lacks the ribosome binding site and ATG start codon present on the pET translation vectors. pET-9a DNA - Novagen Novagen's pET-9a-d (+) vectors carry an N-terminal T7•Tag® sequence and BamH I cloning site. 7k Plasmids: More Plasmid Sets Home Plasmids pET & Duet Vectors (Novagen) The newer pET vectors developed at Novagen offer enhanced features to permit easier cloning, detection, and purification of target proteins. Carries N-terminal pelB signal sequence for potential periplasmic localization. Order now! Novagen's pET-26b (+) vector carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His•Tag ® sequence. PET System Manual contains information on the pET system and its components. It therefore lacks the ribosome binding site and ATG start codon present on the pET translation vectors. Same reading frame as pET-3c but with an NcoI site at the start codon. Novagen has information about the b form but not the a form of pET-22. For other reading frames, use pET-30b(+) or pET-30c(+). For other reading frames, use pET-44b(+) or pET-44c(+). Elevate your target gene expression today! pET-30a(+) DNA - Novagen - a vector enabling expression of proteins with N-terminal His•Tag®, thrombin, S•Tag and enterokinase sequences, plus an optional C-terminal His•Tag. pET-28a (+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. Novagen′s pET-17b vector carries an N-terminal 11aa T7-Tag sequence followed by a region of useful cloning sites with dual BstX I sites, which allow efficient cloning using an asymmetric linker. Novagen's® pET Systems Efficiently clone and express your target protein by cloning your gene into one of our industry leading bacterial, mammalian or insect cell systems. Bacterial vector for inducible expression of N-terminally 10xHis-tagged proteins with an enterokinase site. To see this sequence with restriction sites, features, and translations. Novagen′s pET-30 Xa/LIC vector is designed for cloning and high-level expression of target proteins fused with the His-Tag and S-Tag coding sequences that are cleavable with Factor Xa protease. Bacterial vector for expression of genes with bacterial translation signals. Each Duet vector has compatible replicons and antibiotic resistance markers as shown in the example below. Bacterial vector for expressing GST fusion proteins with a Factor Xa site. PET-32, pET-40 and pET-50 are the most commonly used pET vectors. For other reading frames, use pET-24b(+) or pET-24c(+). Order today! Novagen's pET-21a-d (+) vectors carry an N-terminal T7-Tag sequence plus an optional C-terminal His-Tag sequence. Open in SnapGene Download SnapGene Download Plasmid Explore Over 2. com Provide pET-24a (+) vector/plasmid map, full length sequence, antibiotic resistance, size and other information pET-41a(+) DNA from Novagen, incorporating the schistosomal glutathione-S-transferase (GST•Tag) coding sequence as a fusion partner. com) for a complete listing of pET vectors, systems, and competent cells. Elevate your research potential today! The pET System is the most powerful system yet developed for the cloning and expression of recombinant proteins in Escherichia coli Target genes are cloned in pET plasmids under control of strong bacteriophage T7 transcription and (optionally) translation signals, PmeI SacII SnaBI SpeI SunI SwaI AvrII BsrGI MscI PmlI ScaI SrfI Novagen • FAX 608-238-1388 • E-MAIL novatech@novagen. Sequence Author: MilliporeSigma (Novagen) The pET-16b vector carries an N-terminal HIS TAG ® sequence followed by a Factor Xa site and three cloning sites. Explore its potential for high-level protein expression. Bacterial vector for expression of N-terminally 6xHis-tagged proteins with a thrombin site. pET Expression System 30 - Novagen pET vectors plus host strains with induction control - Find MSDS or SDS, a COA, data sheets and more information. pET-23 (+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. For alternative reading frames, use pET-3b or pET-3c. Includes optional C-terminal His-Tag for purification. Download SnapGene Download SnapGene Viewer Explore Over 2. pET-30b (+) Bacterial vector for expression of N-terminally S-tagged proteins with an enterokinase site. For alternative reading frames, use pET-9b or pET-9c. Separate components and related products: see the Novagen Catalog or Novagen website (www. 7k Plasmids: pET & Duet Vectors (Novagen) | More Plasmid Sets The Novagen pET-22b (+) vector carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His•Tag sequence. Bacterial vector for inducible expression of N-terminally 10xHis-tagged proteins with a Factor Xa site. Novagen's pET-23 (+) is a transcription vector that lacks the ribosome binding site and ATG start codon present on the pET translation vectors. Bacterial vector for expressing proteins with a cleavable N-terminal Strep-Tag II tag and a C-terminal 10xHis tag. Sequence Author: MilliporeSigma (Novagen) Provide pET-15b vector/plasmid map, full length sequence, antibiotic resistance, size and other information pET vector DNA, 10 g each of the indicated plasmids Host bacterial strains BL21, BL21(DE3), and BL21(DE3)pLysS, glycerol stocks1, 2 Induction control clone, glycerol stock pET-19b vector from Novagen, features an N-terminal His•Tag sequence followed by an enterokinase cleavage site and three cloning sites. 7k Plasmids: pET & Duet Vectors (Novagen) | More Plasmid Sets Novagen′s pET-52b (+) vector is designed for cloning and high-level expression of proteins fused with the 8 aa Strep-Tag II coding sequence that is cleavable with human rhinovirus (HRV) 3C protease. Same reading frame as pET-24c(+) but with an NcoI site at the start codon. - Find MSDS or SDS, a COA, data sheets and more information. Bacterial vector for expressing thioredoxin fusion proteins with an enterokinase site. For other reading frames, use pET-41b(+) or pET-41c(+). Provide pET-30a (+) vector/plasmid map, full length sequence, antibiotic resistance, size and other information Novagen′s pET-9a DNA, a foundational pET vector with N-terminal T7-Tag and BamHI cloning site. Merck’s vast portfolio of expression vectors enables you to choose the perfect combination of promoters, epitope tags, antibiotic resistance, and host compatibility. Bacterial vector for expressing GST fusion proteins with an enterokinase site. There are two general categories of vectors available: transcription vectors and translation vectors. Sequence Author: MilliporeSigma (Novagen) Open in SnapGene Download SnapGene Download Plasmid Explore Over 2. For other reading frames, use pET-30a (+) or pET-30c (+). Sep 23, 2024 · The pET expression system The pET system was published by Studier and Moffatt in 1986 1 and further developed by Novagen 2. The pET-28a-c(+) vectors carry an N-terminal His Tag/thrombin/T7 Tag configuration plus an optional C-terminal His Tag sequence. For other reading frames, use pET-21b(+) or pET-21c(+). This vector is particularly suitable for proteins that require post-translational processing to remove the His-tag. The vector encodes two multiple cloning sites, each of which is preceded by a T7 promoter, lac operator and ribosome binding sites. The pET-22b (+) vector carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His•Tag® sequence. Novagen′s pET-32a(+) DNA vector, designed for high-level expression of peptide sequences fused with the 109aa Trx•Tag thioredoxin protein. Ideal for molecular-biology research. Bacterial vector for expressing 6xHis-tagged NusA fusion proteins. jmux 0yb 1xe71ler kxjb36p zw7l oji3 srpuy7 gxz gfv cpfr1ygi